Review

zebrafish quick genotyping dna preparation kit (Bioland Scientific)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Bioland Scientific zebrafish quick genotyping dna preparation kit
Zebrafish Quick Genotyping Dna Preparation Kit, supplied by Bioland Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping+kit/dna+genotyping+kit+preparation+quick+zebrafish/pm42268630-140-9-15
Average 86 stars, based on 1 article reviews

zebrafish quick genotyping dna preparation kit - by Bioz Stars, 2026-11

86/100 stars

Images

Fluorescence:

Article Title: Phenotypic analysis of catastrophic childhood epilepsy genes.
Article Snippet: .. At one dpf, embryos were sorted for fluorescence and genomic DNA extracted using Zebrafish Quick Genotyping DNA Preparation Kit (GT02-02, Bioland Scientific) from pools of 5–10 healthy, microinjected, and un-injected larvae. ..

other:

Article Title: In vivo calcium imaging reveals disordered interictal network dynamics in epileptic stxbp1b zebrafish
Article Snippet: Zebrafish Quick Genotyping DNA Preparation Kit , Bioland Scientific , GT02-01.

Article Title: An Adversarial DNA N 6 -Methyladenine-Sensor Network Preserves Polycomb Silencing
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER MAGnify ChIP kit ThermoFisher Cat#492024 KAPA HyperPrep kit Roche Cat#07962312001 KAPA Stranded mRNA Sequencing kit Roche Cat#07962282001 Deposited Data 6mA SMRT sequencing Wu et al., 2016 GEO: GSE71940 mESC RNA-seq Shen et al., 2012 GEO: GSM723776 ChIP, MeDIP, and RNA sequencing This study GEO: GSE105006 Mendeley dataset This study http://doi.org/10.17632/rfmf3tb5z8.1 Experimental Models: Cell Lines Mouse Mettl4 KO ESCs This study N/A Human HEK293T ATCC Cat#CRL-11268; RRID: CVCL_1926 Experimental Models: Organisms/Strains Mouse: Mettl4em6Dfel: 129/Sv * C57BL/6N This study N/A Oligonucleotides Primers for qPCR Table S3 N/A 6mA consensus Forward: 50-GATGCAAGCATCAGC AAC6mAGAAG6mAGGATCTCAGGTGCAGCGC-30 This study N/A Unmethylated consensus Forward: 50-GATGCAAGCATC AGCAACAGAAGAGGATCTCAGGTGCAGCGC-30 This study N/A Consensus Reverse: 50-Biotin-GCGCTGCACCTGAGAT CCTCTTCTGTTGCTGATGCTTGCATC-30 This study N/A Dam-methylated substrate Forward: 50-ATAACTACACT ATCATGCGCTGACCCACAACATCCGAAGGGATCCAG GTTAAGTAATATAATTGCGCCTTAT-30 This study N/A Dam-methylated substrate Reverse: 50-Biotin-ATAAGG CGCAATTATATTACTTAACCTGGATCCCTTCGGATGTT GTGGGTCAGCGCATGATAGTGTAGTTAT-30 This study N/A 5mC control for pull-down: 50-biotin-GGA CCACCG GTG GTC C-30 This study N/A 5caC control for pull-down Forward: 50-TACACTATCAT GXGCTGACCCACAACATCCGA-30, where X is 5caC This study N/A 5caC control for pull-down Reverse: 50-biotin-TCGGATG TTGTGGGTCAGCGCATGATAGTGTA-30 This study N/A Recombinant DNA Plasmid: pcDNA3.1-HARE-HTH-luciferase This study Addgene plasmid 106427 Plasmid: p3xFlag-Alkbh4 This study Addgene plasmid 105240 Plasmid: p3xFlag-Mettl4 This study Addgene plasmid 86665 Plasmid: pET30a-HARE-HTH This study Addgene plasmid 107164 Plasmid: pET30a-Mpnd-RAMA This study Addgene plasmid 112226 Plasmid: pET30a-MYSM1-RAMA This study N/A Plasmid: p3XFlag-Dam This study Addgene plasmid 121909 Plasmid: p3xFlag-RAMA This study N/A Plasmid: pCMV6-XL4 ASXL1 (p.Y591X) 3x Flag Balasubramani et al., 2015 Addgene plasmid 74261 Plasmid: Flag-HA-BAP1 Sowa et al., 2009 Addgene plasmid 22539 Plasmid: pX330-U6-Chimeric_BB-CBh-hSpCas9 Cong et al., 2013 Addgene plasmid 42230 Plasmid: pAc-GFP-TRIP12 Lukas lab; Gudjonsson et al., 2012 N/A Plasmid: pLKO.1-sh1-Trip12 MilliporeSigma Cat#TRCN0000273207 Plasmid: pLKO.1-sh2-Trip12 MilliporeSigma Cat#TRCN0000022376 (Continued on next page) Molecular Cell 74, 1138–1147.e1–e6, June 20, 2019 e2

Amplification:

Article Title: In vivo calcium imaging reveals disordered interictal network dynamics in epileptic stxbp1b zebrafish
Article Snippet: .. Briefly, genomic DNA was extracted from whole larvae using the Zebrafish Quick Genotyping DNA Preparation Kit (Bioland Scientific). stxbp1b gDNA was amplified using previously described primers , and then digested with enzyme BsiHKAI at 65°C for 2 hours. ..

Isolation:

Article Title: The Placental Transcriptome in Late Gestational Hypoxia Resulting in Murine Intrauterine Growth Restriction Parallels Increased Risk of Adult Cardiometabolic Disease.
Article Snippet: .. DNA was isolated from ~0.2 cm tail samples using the Bioland Quick Genotyping DNA preparation kit (Bioland Scientific, Paramount, CA, USA), according to the manufacturer’s protocol. .. DNA was quality checked using Nanodrop prior to genotyping.